Lenti-SV40 virus

Lentivirus vector with complete SV40 genome
  • Cat.-#: CIP-0011
    Unit Size: 10ml
    Price, $: 1,175.00

Lenti-SV40 virus Description

Lenti/SV40 virus is a recombinant lentivirus containing SV40 T-antigens (both large and small) and viral coating proteins. The virus can be used to infect primary target cells for cell immortalization. The SV40 genome is over 5kb, which exceeds the packaging limit of the lentiviral vector thus resulting in either very low or no lentiviral titer yield. The puromycin selection marker has been removed from the vector to allow high titers of Lenti-SV40 virus to be produced. It is not always necessary to use a selection marker for most primary cell immortalizations, especially for epithelial cells that normally have less than 10 population doubling cycles in culture. The unimmortalized cells will not survive and only the immortalizaed cells will thrive.

Lenti-SV40 virus Specification

Vector: pLV-SV40
Vector Type: Lentiviral Vector
Viral Titer: 106cfu/ml
Antibiotic Information: No selection marker
Sequencing Primers: (2941-2860) 5'---TGTACGGTGGGAGGTCTATA ---3'
Additional Information: Cloned through EcoR I
Primers for RT-PCR: Forward (GACTCAGGGCATGAAACAGG); Reverse (ACTGAGGGGCCTGAAATGA)