Products
Services
- Telomere Maintenance Mechanism Assays
- Construction of siRNA-Lenti and siLenti-EGFP vectors
- Custom Lentivirus Construction
- Lentivirus Production
- Custom Avenovirus Construction
- Adenovirus Production
- Primary Cells Immortalization
- Stable Cell Line Production
- Multiplexed Protein Assay
- Protein Production
- miRNA Profiling
- Construction of miRNA Lentivirus Vectors
- Mouse Monoclonal Antibody Production
Lenti-SV40 virus
| Product Support |
|
|
Lenti-SV40 virus Description
Lenti/SV40 virus is a recombinant lentivirus containing SV40 T-antigens (both large and small) and viral coating proteins. The virus can be used to infect primary target cells for cell immortalization. The SV40 genome is over 5kb, which exceeds the packaging limit of the lentiviral vector thus resulting in either very low or no lentiviral titer yield. The puromycin selection marker has been removed from the vector to allow high titers of Lenti-SV40 virus to be produced. It is not always necessary to use a selection marker for most primary cell immortalizations, especially for epithelial cells that normally have less than 10 population doubling cycles in culture. The unimmortalized cells will not survive and only the immortalizaed cells will thrive.
Lenti-SV40 virus Specification
| Vector: | pLV-SV40 |
| Vector Type: | Lentiviral Vector |
| Viral Titer: | 106cfu/ml |
| Antibiotic Information: | No selection marker |
| Sequencing Primers: | (2941-2860) 5'---TGTACGGTGGGAGGTCTATA ---3' |
| Additional Information: | Cloned through EcoR I |
| Primers for RT-PCR: | Forward (GACTCAGGGCATGAAACAGG); Reverse (ACTGAGGGGCCTGAAATGA) |
Data Sheets |
|
|